Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 2 | Shotgun SILAC-proteomics discovery approach. (a) Schematic of stable isotope labelling with amino acid in cell culture for MS analysis (SILAC-MS/MS). Acid-adapted and naive MCF-7 cells were grown either in media of normal isotopic distribution or in heavy (D6-Lys, D 10-Arg) medium for eight doublings (1 week). The cells were collected and lysed and combined for equal protein loads between the two groups. A label-flipping approach was employed through a parallel experiment, allowing for confident quantification and reducing false-positive biomarker associations. (b) The Venn diagrams show the number of protein discovered in each flipping experiment. The number underneath the diagram is the total protein number. Orange is the number of proteins with heavy label and blue with the light label. The graph beside the Venn diagram is observed log2 peak area ratios for flipping experiments plotted on the same graph. Candidate biomarkers were selected among proteins showing at least a 1.5-fold increase in expression under acidic conditions in both replicates across flipping experiments. (c) A Pie chart of proteins with increased expression in acid-adapted cells. In all, 45% of the proteins are cytoplasmic and 55% membrane proteins of which 12.8% are lysosomal and endosome proteins. (d) LC-MRM validation of discovered low-pH-induced proteins. MS/MS spectra of peptides from LAMP2 shown here, was extracted from our shotgun data set and used for the development of targeted multiple reaction monitoring (MRM) assays (optimized transitions indicated in red). Bottom panel: relative quantification was accomplished by comparing peak areas using Skyline.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Multiplex sample analysis, Cell Culture, Tandem Mass Spectroscopy, Biomarker Discovery, Expressing, Membrane, Targeted Proteomics

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 3 | In vitro confirmation of proteomics results. (a) Quantitative reverse transcription–PCR and (b) western blot and (c) ICC results confirmed the higher expression level of LAMP2 in AA cells relative to NA MCF-7 cells. (d) LAMP2 siRNA treatment of NA and AA MCF-7 cells decreased the viability of acid-adapted cells much more than non-adapted cells. (e) siRNA treatment of spheres of AA and NA MCF-7 cells revealed that growth and size of AA spheres are affected by LAMP2 expression. The graph shows the average pixel count of spheres from both groups with error bars as s.d. (f) Representative images of spheroid 3D culture model (Rotary system) of MCF-7 cells showing the increased expression of LAMP2 close to the central part of the tumours at the oxygen diffusion limit (B200 mm). (g) Representative images of heterogeneous LAMP2 expression (black arrow in IHC analysis) indicate high expression of LAMP2 at the suspected acidic regions of mouse tumour xenografts, such as the necrotic area neighbourhood and invasive edges.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: In Vitro, Reverse Transcription, Western Blot, Expressing, Diffusion-based Assay

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 4 | Correlation of marker expression with tumour pH using intravital imaging of SNARF-1 in DWC followed by IHC staining. (a) Regional extracellular tumour pH was determined by intravital imaging of the pH-sensitive fluorescent dye, SNARF-1, in breast cancer DWC xenograft tumours using an olympus multiphoton microscope. (b) Representative pH maps generated by the SNARF-1 ratiometric analysis on day 16 post tumour inoculation. Acidity ranges from low pH (black) to normal pH (white), meaning black is the most acidic area and white the least. (c) After the final SNARF-1 imaging, the tumours were extracted and fixed in the same orientation they were imaged and IHC stained for LAMP2 expression. The two left panels represent images of marker IHC staining for LAMP2 in two magnifications. (d) IHC staining images superimposed over the corresponding pH map (white, light grey, dark grey and black) to correlate the acidity of each region to expression of LAMP2 in the corresponding area. The stained tumours in each mapped region for acidity were analysed using positive pixel analysis by our custom-trained software in Definiene. The number in each box represents the percentage of cells that are LAMP2 positive. The correlation analysis showed significantly higher expression of LAMP2 in acidic areas of the tumours compared with non-acidic regions (Student’s t-test, Po0.001 and error bars represent s.d.).

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Marker, Expressing, Imaging, Immunohistochemistry, Microscopy, Generated, Staining, Software

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 5 | Effect of NaHCO3 buffer therapy on LAMP2 expression. (a) IHC staining of LAMP2 in representative cross-sections of ZR-75.1 tumours treated with tap water and NaHCO3 (left) or tap water (right), respectively. Positive pixel analysis of LAMP2 staining was carried out using Aperio Positive Pixel Count v9 (two columns in the middle; red is strong positive). (b) Positive pixel analysis of LAMP2 was compared with GLUT1 and CA9 as controls. A significant decrease in the percentage of strong positive LAMP2 pixels was observed in NaHCO3-treated cross-sections with much less decrease in GLUT1 expression and no significant change in CA9 expression. The data are plotted as the mean þ s.d.) of six tumour per mouse from each group. (c) Bioluminescence images of luciferase activity in the primary tumours of MDA-mb-231/Luc with non-silencing shRNA (left) versus LAMP2 knockdown clone D5 (right) xenografted in nude mice. LAMP2 knockdown tumours had less activity and grew more slowly. (d) Tumour size comparison of knocked down LAMP2 clones versus the non-silencing group using caliper. LAMP2 knockdowns had very slow growth rate at the early stage of tumour growth. (e) Representative images of metastases into axillary lymph node of LAMP2 knockdown cells (N ¼ 5 mice) and non-silencing vector cells (N ¼ 5 mice). Knocking down LAMP2 reduces the metastasis of cancer cells significantly (Student’s t-test, Po0.001, error bars represents mean with s.d.).

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Expressing, Immunohistochemistry, Staining, Luciferase, Activity Assay, shRNA, Knockdown, Comparison, Clone Assay, Plasmid Preparation

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 6 | Translational study for LAMP2 expression in breast cancer samples. (a) Microarray mRNA expression profile of LAMP2 in breast cancer tumours and normal tissue samples. Data are represented as mean þ s.d. Note the log10 scale of RNA expression. (b) Percent positivity of LAMP2 IHC staining of cores from the breast cancer patient samples TMA containing 201 biopsy cores. A consecutive raise in LAMP2-positive staining pattern was observed with the progress of breast tumours from DCIS to invasive ductal carcinoma with metastasis. (c) Representative images of analysed TMA cores from each stage with the corresponding illustration from the schematic model of breast cancer progression at the bottom. (d) Overexpression of LAMP2 in acidic regions of breast cancer tumours. IHC staining of a DCIS with LAMP2 antibody showed overexpression of this protein in regions expected to be more acidic such as centres of DCIS or DCIS with microinvasion. Underneath each IHC panel is a colour-coded picture of the IHC section based on LAMP2 positivity (0–3) for better understanding.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Expressing, Microarray, RNA Expression, Immunohistochemistry, Staining, Over Expression

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 7 | Proposed acid-adaptation mechanism. (a) LAMP2 expression in normal and cancer cells in breast tumour samples. LAMP2 membrane overexpression is indicated by arrows in breast cancer tumours (DCIS) in the right-most image that is a zoom-in of the yellow box in its neighbour. (b) LAMP2 expression in chronically acid-adapted cells versus non-adapted by ICC. To make sure LAMP2 is at the cell surface and not just cell periphery, we added wheat germ agglutinin (WGA) as a membrane marker to the cells; co-registration of LAMP2 and WGA was measured (merge) and confirmed membrane expression of LAMP2. (c) Membrane expression of LAMP2. Western blot of membrane protein extracted from AA and NA MCF-7 cells shows higher expression of LAMP2 at the cell surface of AA cells. (d) Schematic presentation of LAMP2 role in acid adaptation of cancer cells. In chronic acidosis, a possible mechanism could involve the exocytosis of more acidic lysosomes. This strategy helps the cells to secrete large amounts of acid in one step, and also by presenting of LAMP2 at the cell membrane protects themselves from acid degradation. LAMP2 with hydrated hyper-branched carbohydrate chains can protect the membrane against acidity. (e) The cathepsin-B assay in the media of AA and NA MCF-7 cells; AA MCF-7 cells secrete significantly more cathepsin B into their extracellular environment, consistent with increased lysosomal turnover rates.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Expressing, Membrane, Over Expression, Marker, Western Blot

Journal: Cell reports

Article Title: Aging disrupts sympathetic innervation of the thymus

doi: 10.1016/j.celrep.2026.117126

Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Article Snippet: qPCR Primer – Lamp2 FW: GAGCAGGTGCTTTCTGTGTCTAG Rev: GCCTGAAAGACCAGCACCAACT , Origene , SKU: MP222524.

Techniques: Labeling, MANN-WHITNEY